Wednesday, May 16, 2012

Friday, May 4, 2012

bio.task.worksheet

Jocelyn Castaneda,

Samantha Muniz,

Danielle Valerio.

EXPLORING MOLECULAR EVOLUTION

STUDENT WORKSHEE


Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:
  1. Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
    1. The chimp?
GGACAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGT
GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC
CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG
GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT
TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA
CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG
AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT
TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC
ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC




    1. The human?
ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC



  1. A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.
99

  1. Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.
            
We would expect it to be similar because, we have a lot of the same trades as chimps. Both of the human and chimp walk on two feet. And the theory of evolution would make us say it would be similar.



RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:
  1. What is the percentage of sequence conservation between the beta globin gene in chickens and humans? Work this out using the second line of nucleotides only.
        57


  1. Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
       
        We would expect the protein found in humans to be similar to chimps because the percentage of the “score” was 99% for chimps & humans. But for the chickens and humans it was only 57%.  




  1. Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology? Explain.  

            Yes, because chimps and humans are more relative then chickens and humans. The percentage was way off when it was chickens and humans. But the percentage for humans and chimps was close it was “99%”.


RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS


Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:
  1. Examine the Unrooted Tree produced.  
Record the species at the end of each branch on the unrooted tree shown below.







  1. Based on the information in the unrooted tree:
    1. Which two species appear to be most closely related to each other? Explain your choice.
Chimps and Humans because they have similar characteristics.

    1. Which two species seem to be the least closely related to each other? Explain your choice.
Chicken and mouse because the percentage score is lower than the rest.
  1. Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (in mm) between:
    1. The mouse and human
79
    1. The wallaby and the human
            75
    1. The chimp and the human
                99
Comment on the significance of these results given your knowledge of mammalian groups.




RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS


Results of your Rooted Phylogenetic Tree:
  1. Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.  



  1. Based on this tree diagram, which species is/are most closely related to:
    1. The goldfish:
        chicken
    1. The mouse:
    Human
  1. Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?
                        Chimps and Humans
  1. A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.
            Chimps and Humans


  1. Looking at the phylogentic tree above, which two organisms:
    1. Diverged from their common ancestor most recently?
                Chimp and Human
       
    1. Diverged from their common ancestor least recently?
                Wallaby

  1. Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.



  1. It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.
  • GENES- Is used to determine the order of the base pairs in a segment of RNA or DNA
  • DNA- The set of non-genetic traits, qualities, or features that characterize a person.

  • Morphology- A branch of bio-science dealing with the study of the form and structure of organisms and their specific structural features.



Bacterial ID lab Questions

Tuesday, April 17, 2012

DNA Lab

GATTACA

6. At the end of the film, you are told that the Doctor knew about Vincent all along. Why did the Doctor go along with the fraud? What would you have done if you were the Doctor?
I think the Doctor with along with it because he has a son too, and his son is like what they call not the right kind. So the doctor figures that if Vincent can do it then maybe other in-valid can do it to. Also he might have an idea that maybe people are wrong about these "in-valid" people. If I was the Doctor I would keep it to myself just like he did just to see if the other kind was able to do it too.

2. Why do you think Vincent left his family, tearing his picture out of the family photo, after winning the swimming race against his brother?

I think Vincent figured that if he could finally beat he's brother at the swimming race, then maybe there is a way that he can do other things too and since he's family didn't believe he could, he decides to not be related to them.
 
3. Describe the relationship between Vincent and Anton.


Vincent and Anton had a love, hate relationship with each other. Vincent hated how much attentions Anton would get because unlike himself, Anton was made right. But they both knew they're brothers so the love each other either way.
 
11. Picture yourself as either Vincent, Jerome, or Anton. Would you have acted the same or done things differently if you were in the same world as them?


If i was Vincent, I would have act the same way as he did. I would have treat anything to reach my goal if i felt as strong as Vincent did during the movie. If i was Jerome, I would have less motivation then what he had to keep going as much as he did. It would have took me a while to even think about helping out a stranger like what he had done. If I was Anton, I would feel sorry for my brother at times then I would be somewhat stuck up for being made "Right." Other times i would ask myself "why i was made right, and he wasn't." 



5. Choose your favorite character from the film. Explain why you choose that person. Would you want to be that person? Why? Why not?

My favorite character from the film was Vincent. He knew he wasn't the right kind but still believed in himself even when nobody did. Everybody tried to put him down but no one was able to break his dream which had lead him to going put to space like he had always dream about. If we lived like how Vincent did, then yes i would want to be that person that could say, I wasn't born like you were but I still could do the same things as you didn't think I could.