Wednesday, May 16, 2012
Tuesday, May 8, 2012
Friday, May 4, 2012
bio.task.worksheet
Jocelyn Castaneda,
Samantha Muniz,
Danielle Valerio.
EXPLORING MOLECULAR EVOLUTION
STUDENT WORKSHEE
Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:
- Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
- The chimp?
GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC
CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG
GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT
TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA
CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG
AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT
TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC
ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- The human?
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.
99
- Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.
We
would expect it to be similar because, we have a lot of the same trades
as chimps. Both of the human and chimp walk on two feet. And the theory
of evolution would make us say it would be similar.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:
- What is the percentage of sequence conservation between the beta globin gene in chickens and humans? Work this out using the second line of nucleotides only.
- Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
We would expect the protein found in humans to be similar to chimps because the percentage of the “score” was 99% for chimps & humans. But for the chickens and humans it was only 57%.
- Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology? Explain.
Yes, because chimps and humans are more relative then chickens and humans. The percentage was way off when it was chickens and humans. But the percentage for humans and chimps was close it was “99%”.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:
- Examine the Unrooted Tree produced.
Record the species at the end of each branch on the unrooted tree shown below.
- Based on the information in the unrooted tree:
- Which two species appear to be most closely related to each other? Explain your choice.
- Which two species seem to be the least closely related to each other? Explain your choice.
- Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (in mm) between:
- The mouse and human
79
- The wallaby and the human
- The chimp and the human
Comment on the significance of these results given your knowledge of mammalian groups.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your Rooted Phylogenetic Tree:
- Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.
- Based on this tree diagram, which species is/are most closely related to:
- The goldfish:
chicken
- The mouse:
Human
- Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?
- A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.
- Looking at the phylogentic tree above, which two organisms:
- Diverged from their common ancestor most recently?
- Diverged from their common ancestor least recently?
- Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.
- It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.
- GENES- Is used to determine the order of the base pairs in a segment of RNA or DNA
- DNA- The set of non-genetic traits, qualities, or features that characterize a person.
- Morphology- A branch of bio-science dealing with the study of the form and structure of organisms and their specific structural features.
Tuesday, April 17, 2012
GATTACA
6. At the end of the film, you are told that the Doctor knew about Vincent all along. Why did the Doctor go along with the fraud? What would you have done if you were the Doctor?
I think the Doctor with along with it because he has a son too, and his son is like what they call not the right kind. So the doctor figures that if Vincent can do it then maybe other in-valid can do it to. Also he might have an idea that maybe people are wrong about these "in-valid" people. If I was the Doctor I would keep it to myself just like he did just to see if the other kind was able to do it too.
2. Why do you think Vincent left his family, tearing his picture out of the family photo, after winning the swimming race against his brother?
I think Vincent figured that if he could finally beat he's brother at the swimming race, then maybe there is a way that he can do other things too and since he's family didn't believe he could, he decides to not be related to them.
3. Describe the relationship between Vincent and Anton.
3. Describe the relationship between Vincent and Anton.
Vincent and Anton had a love, hate relationship with each other. Vincent hated how much attentions Anton would get because unlike himself, Anton was made right. But they both knew they're brothers so the love each other either way.
11. Picture yourself as either Vincent, Jerome, or Anton. Would you have acted the same or done things differently if you were in the same world as them?
If i was Vincent, I would have act the same way as he did. I would have treat anything to reach my goal if i felt as strong as Vincent did during the movie. If i was Jerome, I would have less motivation then what he had to keep going as much as he did. It would have took me a while to even think about helping out a stranger like what he had done. If I was Anton, I would feel sorry for my brother at times then I would be somewhat stuck up for being made "Right." Other times i would ask myself "why i was made right, and he wasn't."
5. Choose your favorite character from the film. Explain why you choose that person. Would you want to be that person? Why? Why not?
Thursday, April 5, 2012
Thursday, March 15, 2012
Monday, March 5, 2012
Monday, February 27, 2012
Friday, February 24, 2012
Tuesday, February 21, 2012
EUGENICS
What is eugenics?
Well eugenics is a theory that humans could influence their own evolution. Its like saying that anyone could choses their genes. For them to pick out the “bad” genes and to just leave the good ones. People believe that by selecting their own breed they could improve there genetic qualities. In other words humans would be "well born”. So there wouldn’t be no more criminals nor mental patients to worry about.
Well eugenics is a theory that humans could influence their own evolution. Its like saying that anyone could choses their genes. For them to pick out the “bad” genes and to just leave the good ones. People believe that by selecting their own breed they could improve there genetic qualities. In other words humans would be "well born”. So there wouldn’t be no more criminals nor mental patients to worry about.
What were the social origins of eugenics?
The social origins had came around after the civil war by Sir Francis Galton. Since the war had ended there had been a lot of social and economic problems all over. The world had started to changes. Business's started to go bankrupt. High class and educated people were only have one or two kids while the lower classes were having a lot more. Then after all this started to happen the people started to believe in eugenics.
What were the scientific origins of eugenics?
The scientific origin of eugenics was that the only way to stop the "bad genes" were by sterilization. Sterilization is the process of an operation or a way to stop the individual from reproducing. According to Sir Francis Galton it was a moral philosophy to improve humanity. Many criminals and mental patients were put on this, so they could be free. A lot of health people were encouraged to keep having more children.
What research methods were used to study eugenics and what were their flaws?
The research methods that were used was pedigrees. Pedigrees are like family trees. But in pedigrees dominant and recessive genes are the ones being shown. Dominant gene are shown, while recessive are the ones that won't show up. The method they used was basically just tracing traits of a person.
How did eugenics research impact American society?
Eugenics had many ways on impacting American society. There was marriage laws, sterilization laws and immigration restriction in America. A lot of couples went to consult a genetic counselor to see if they would be a good match with one and other when it came to reproduce. Americans realized that the way things were being "solved" wasn't the way they needed too.
This is what I learn over eugenics. It wasn’t the right way to solve thing and Americans started to figure it out. No gene is really the “bad” gene because any of them could casue problems. Sterilization wasn’t the solutions either. Aslo, they should have tried to figure out a way to cure them or just let them be. It was somewhat good though that they tested them so that we know the difference and how it is a heredity problem but the way they tested the people was wrong and not necessary.
Monday, February 6, 2012
Stem Cells
Definitions
Cell-based Therapies- Treatment in which stem cells are induced to differentiate into the specific cell type required to repair damaged or destroyed cells or tissues.
Differentiation- The process where by an unspecialized embryonic cell acquires the features of a specialized cells. (heart, liver, or muscle cell)
Embryonic Stem Cell Line- Primitive cells that are derived from preimplantation-stage embryos, are capable of dividing without differentiating for a prolonged period in culture, and are known to develop in cells and tissues of the three primary germ layers.
Proliferation- Expansion of the number cells by the continuous division of single cells into two identical daughter cells.
Plasticity-
Pluripotent- The state of a single cell that is capable of differentiating into all tissues of an organism, but not alone capable of sustaining full organismal development
QUESTIONS
3) The diseases that scientists are looking at to be cured by stem cells are the serious diseases, such as birth defects and cancer. Replacement cells for extreme burns could also be a use for stem cells.
4) To be useful in curing any kind of disease the stem cells needs to be able to do a lot of things, like avoid harming the recipient in anyway, or differentiate into the desired cell types, and survive in the surrounding tissue after transplant.
http://stemcells.nih.gov/info/basics/defaultpage.asp
1) The unique properties of all stem cells are; capable of dividing and renewing themselves for long periods, they can give rise to specialized cell types, and they are unspecialized.
2) The two different types of stem cells are adult stem cells and embryonic stem cells. These stem cells are different by the number and type of differentiated cells. Adult stem cells are more limited in what they can become while, Embryonic stem cells can become all kinds of cells in the body.
3) The diseases that scientists are looking at to be cured by stem cells are the serious diseases, such as birth defects and cancer. Replacement cells for extreme burns could also be a use for stem cells.
http://stemcells.nih.gov/info/basics/defaultpage.asp
Tuesday, January 31, 2012
Tuesday, January 17, 2012
Cancers
There is many types of cancer. Some cancer are more common then other. Doesn't matter how young or old you are to get cancer. No one wants it they just end up getting it. There is treatments but sometimes they are just not enough. Here are some types of cancer; Lymphoma, Liver, Leukemia, Melanoma, Breast, and there probably are more then just these. But the cancers that i had just listed are more common in the young adult.
Lymphoma- immune system
Liver- Forms in the tissues of the liver
Leukemia- Starts in Blood-forming tissues, Large numbers of blood cells enter to the blood stream.
Melanoma- Begins in melanocytes, it can begin as a mole
Breast- Forms in the tissues of the breast
Lymphoma- immune system
Liver- Forms in the tissues of the liver
Leukemia- Starts in Blood-forming tissues, Large numbers of blood cells enter to the blood stream.
Melanoma- Begins in melanocytes, it can begin as a mole
Breast- Forms in the tissues of the breast
Monday, January 16, 2012
Subscribe to:
Posts (Atom)
